Back to HOME

Vitamin D


DATA No : VVD0285 INFORMANT : Sachiko Yamada

NAME : (5Z,7E)-(1S,3R)-9,10-seco-5,7,10(19)-cholestatriene-1,3,25-triol

COMMON NAME: 1a,25-dihydroxyvitamin D3 / 1a,25-dihydroxycholecalciferol / calcitriol
SYMBOL: 1a,25-(OH)2D3
FORMULA: C27H44O3 MOL.WT (average) : 416.636


Download ChemDraw structure data
BIOLOGICAL ACTIVITY
Mechanism of action of 1,25-(OH)2D3: (Ref. 0027/0028)
Clinical use: (Ref. 0058/0059)
Cell differentiation: Table (Ref. 0060)
Relative effects of 1a,25-(OH)2D3 and its A-ring diastereomers on components of the vitamin D endocrine system:Table (Ref. 0183)
Dissociation constant (Kd) for vitamin D receptor (VDR): 8.2 pm10 -11 (Ref. 0235); Kd, Mammalian VDR: 10-11 - 10-10M : (Ref. 0184)<
PHYSICAL AND CHEMICAL PROPERTIES
MELTING POINT:106-112 degC (Ref. 0024)

BOILING POINT:

REFRACTIVE INDEX:

OPTICAL ROTATION:[a]D +29 deg (in Et2O) (Ref. 0024)

DENSITY:

SOLUBILITY:
SPECTRAL DATA
UV SPECTRA:(Et2O) lmax (nm) (e) 264 (18000), lmin (nm) (e) 228.5 (10100) (Ref. 0024)

IR SPECTRA:

NMR SPECTRA:1H-NMR (d, CDCl3, 500MHz) 0.54 (3H, s, 18-CH3), 0.94 (3H, d, J = 6.2 Hz, 21-CH3), 1.20 (6H, s, 26-, 27-CH3), 2.32 (1H, dd, J = 13.6 and 6.7 Hz, 4b-H), 2.59 (1H, dd, J = 13.5 and 3.4 Hz, 4a-H), 2.83 (1H, dd, J = 11.8 and 3.7 Hz, 9b-H), 4.23 (1H, tt, J = 6.5 and 3.5 Hz, 3a-H), 4.43 (1H, dd, J = 7.5 and 4.0 Hz, 1b-H), 5.00 (1H, br s, 19-H), 5.33 (1H, br t, J = 1.4 Hz, 19-H), 6.02 (1H, d, J = 11.3 Hz, 7-H), 6.38 (1H, d, J = 11.3 Hz, 6-H) (Ref. 0025)
13C-NMR (d, CD3OD-CFCl3, 67.5MHz) spectrum (Ref. 0025)

MASS SPECTRA:m/z 416 (M+), 287, 269, 251, 152, 134 (Ref. 0026)

OTHER SPECTRA:X-ray crystal structure: (Ref. 0186)
CHROMATOGRAM DATA

SOURCE
Isolation and identification: from chicken intestine (Ref. 0026/0027); from chick kidney homogenates incubated with 25-OHD3. (Ref. 0028); from plants such as Solanum malacoxylon. (Ref. 0063)
Concentration in human plasma: 20-65 pg/ml (Ref. 0029)

CHEMICAL SYNTHESIS
From 25-hydroxycholesterol: Dehydration, epoxidation, and reductive deconjugation of the resulting 1,2-epoxy-4,6-dien-3-one gave the key intermediate, 1a,25-dihydroxycholesterol, which was converted to 1a,25-(OH)2D3 by standard procedures of dehydration to the provitamin D, uv irradiation, and thermal isomerization. (Ref. 0024)
From 6-methoxy-3,5-cyclo-24-homocholanic acid via 1a,3b,25-triacetoxy cholestan-6-one as a key intermediate. (Ref. 0035)
From 25-OHD3 via 3,5-cyclovitamin D derivative by SeO2 oxidation as a key step. (Ref. 0062)
Total chiral synthesis from d-carvone as an A-ring precursor and tetrahydroindan-5-one derivative as a CD-ring precursor. (Ref. 0357)
METABOLISM
Biosynthesis: Hydroxylation of 25-OHD3 by 1a-hydroxylase, a cytochrome P450 (CYP24B1) (Ref. 0030/0031) located in the kidney (Ref. 0017/0018/0022) .
Further metabolism (catabolism), 24-Hydroxylation pathway: 24-Hydroxylation by vitamin D-24-hydroxylase (CTP24) (Ref. 0031/0033) to give 1,24R,25-(OH)3D3 (Ref. 0065/0034/0066) which is further oxidized by the same enzyme to 1-OH-tetranor-D3 23-carboxylic acid (calcitroic acid) (Ref. 0070/0073) via 1,25-(OH)2-24-oxo-D3 (Ref. 0068/0067) , 1,23,25-(OH)3D3-24-oxo-D3 (Ref. 0067) and 1,23-(OH)2-tetranor-D3 (Ref. 0069) . 23-Hydroxylation pathway: 1,25-(OH)2D3 is also metabolized to 1,25R-(OH)2D3 26,23S-lactone (Ref. 0077) via 1,23S,25-(OH)3D3 (Ref. 0076) , 1,23,25,26-(OH)4D3 (Ref. 0084) , and 1,25R-(OH)2D3 26,23S-lactol (Ref. 0084). 26-Hydroxylation pathway: Kidney homogenates from vitamin D-supplemented chicks convert 1,25-(OH)2D3 to 1,25.26-(OH)3D3. (Ref. 0087)
GENETIC INFORMATION
Vitamin D receptor (VDR), Avian receptor: (Ref. 0037/0038/0039) ; Human receptor: (Ref. 0040) ; Rat receptor: (Ref. 0041/0042); Mouse receptor : (Ref. 0043) .
VDR knock out mice: (Ref. 0057) .
Dissociation constant (Kd, Mammalian) : 10-11 - 10-10M: (Ref. 0184)
Relationship between vitamin D receptor alleles and born density: (Ref. 0185)
Vitamin D responsive elements (VDRE) sequences
1) Calcium binding protein (CaBP) 9K : GGGTGT CGG AAGCCC (Ref. 0044)
2) Rat osteocalcin : GGGTGA ATG AGGACA (Ref. 0045)
3) Human osteocalcin : GGGTGA ACG GGGGCA (Ref. 0046/0047)
4) Mouse osteopontin : GGTTCA CGA GGTTCA (Ref. 0048)
5) Rat 24-hydroxylase,distal : GGTTCA GCG GGTGCG (Ref. 0049)
6) Human 24-hydroxylase,distal : AGTTCA CCG GGTGTG (Ref. 0050)
7) Rat 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GTG AGGGCG (Ref. 0051)
8) Human 24-hydroxylase,proximal : GAGTCA GCG AGGTGA GCG AGGGCG (Ref. 0050)
9) Human PTH : GGTTCA AAG CAGACA (Ref. 0052)
10) Mouse calbindin D28K : AGGTGA TGA AAGTCA (Ref. 0053)
11) Chicken carbonic anhydrase-II : GGGGGA AAA AGTCCA (Ref. 0054)
12) Human calbindin D9K : TGCCCTTCCTTATGGGGTTCA (Ref. 0055)
13) Mouse calbindin D28K : CTGGGGGATGTGAGGAGAAATGAGTCTGAGC (Ref. 0056)
NOTE

REFERENCES
[0017]
AUTHOR:DeLuca, H. F., and Schnoes, H. K.
TITLE:Metabolism and mechanism of action of vitamin D PubMed ID:183601
JOURNAL:Annu Rev Biochem.
VOL:45 PAGE : 631-666 (1976)
[TOP]

[0018]
AUTHOR:DeLuca, H. F., and Schnoes, H. K.
TITLE:Vitamin D: recent advances PubMed ID:6311080
JOURNAL:Annu Rev Biochem.
VOL:52 PAGE : 411-439 (1983)
[TOP]

[0022]
AUTHOR:Fraser, D. R., and Kodicek, E.
TITLE:Unique biosynthesis by kidney of a biological active vitamin D metabolite PubMed ID:4319631
JOURNAL:Nature.
VOL:228 PAGE : 764-766 (1970)
[TOP]

[0024]
AUTHOR:Barton, D. H. R.; Hesse, R. H.; Pechet, M. M.; Rizzardo, E.
TITLE:Convenient Synthesis of Crystalline 1a,25-Dihydroxyvitamin D3.
JOURNAL:J. Chem. Soc. Chem. Comm.
VOL: PAGE : 203 -204 (1974)
[TOP]

[0025]
AUTHOR:Eguchi, T.; Ikekawa, N.
TITLE:Conformational Analysis of 1a,25-Dihydroxyvitamin D3 by Nuclear Magnetic Resonance.
JOURNAL:Bioorg. Chem.
VOL:18 PAGE : 19 -29 (1990)
[TOP]

[0026]
AUTHOR:Holick, M. F., Schnoes, H. K., DeLuca, H. F., Suda, T., and Cousins, R. J.
TITLE:Isolation and identification of 1,25-dihydroxycholecalciferol. A metabolite of vitamin D active in intestine PubMed ID:4326883
JOURNAL:Biochemistry.
VOL:10 PAGE : 2799-2804 (1971)
[TOP]

[0027]
AUTHOR:Holick, M. F., Schnoes, H. K., and DeLuca, H. F.
TITLE:Identification of 1,25-dihydroxycholecalciferol, a form of vitamin D3 metabolically active in the intestine PubMed ID:4323790
JOURNAL:Proc Natl Acad Sci U S A.
VOL:68 PAGE : 803-804 (1971)
[TOP]

[0028]
AUTHOR:Lawson, D. E., Fraser, D. R., Kodicek, E., Morris, H. R., and Williams, D. H.
TITLE:Identification of 1,25-dihydroxycholecalciferol, a new kidney hormone controlling calcium metabolism PubMed ID:4323313
JOURNAL:Nature.
VOL:230 PAGE : 228-230 (1971)
[TOP]

[0029]
AUTHOR:Shimizu, M., Wang, X., and Yamada, S.
TITLE:Fluorimetric assay of 1 alpha,25-dihydroxyvitamin D3 in human plasma PubMed ID:9106025
JOURNAL:J Chromatogr B Biomed Sci Appl.
VOL:690 PAGE : 15-23 (1997)
[TOP]

[0030]
AUTHOR:Takeyama, K., Kitanaka, S., Sato, T., Kobori, M., Yanagisawa, J., and Kato, S.
TITLE:25-Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis PubMed ID:9295274
JOURNAL:Science.
VOL:277 PAGE : 1827-1830 (1997)
[TOP]

[0031]
AUTHOR:Shinki, T., Shimada, H., Wakino, S., Anazawa, H., Hayashi, M., Saruta, T., DeLuca, H. F., and Suda, T.
TITLE:Cloning and expression of rat 25-hydroxyvitamin D3-1alpha-hydroxylase cDNA PubMed ID:9371776
JOURNAL:Proc Natl Acad Sci U S A.
VOL:94 PAGE : 12920-12925 (1997)
[TOP]

[0033]
AUTHOR:Chen, K. S., Prahl, J. M., and DeLuca, H. F.
TITLE:Isolation and expression of human 1,25-dihydroxyvitamin D3 24-hydroxylase cDNA PubMed ID:8506296
JOURNAL:Proc Natl Acad Sci U S A.
VOL:90 PAGE : 4543-4547 (1993)
[TOP]

[0034]
AUTHOR:Kleiner-Bossaller, A.; DeLuca, H. F.
TITLE:Formation of 1,24,25-Trihydroxyvitamin D3 from 1,25-Dihydroxyvitamin D3.
JOURNAL:Biochim. Biophys. Acta
VOL:338 PAGE : 489 -495 (1974)
[TOP]

[0035]
AUTHOR:Semmler, E. J.; Holick, M. F.; Schnoes, H. K.; DeLuca, H. F.
TITLE:The Synthesis of 1a,25-Dihydroxycholecalciferol : A Metabolically Active from of Vitamin D3.
JOURNAL:Tetrahedron Lett.
VOL:40 PAGE : 4147 -4150 (1972)
[TOP]

[0037]
AUTHOR:McDonnell, D. P., Mangelsdorf, D. J., Pike, J. W., Haussler, M. R., and O'Malley, B. W.
TITLE:Molecular cloning of complementary DNA encoding the avian receptor for vitamin D PubMed ID:3029866
JOURNAL:Science.
VOL:235 PAGE : 1214-1217 (1987)
[TOP]

[0038]
AUTHOR:Pike, J. W., Sleator, N. M., and Haussler, M. R.
TITLE:Chicken intestinal receptor for 1,25-dihydroxyvitamin D3. Immunologic characterization and homogeneous isolation of a 60,000-dalton protein PubMed ID:3027085
JOURNAL:J Biol Chem.
VOL:262 PAGE : 1305-1311 (1987)
[TOP]

[0039]
AUTHOR:Elaroussi, M. A., Prahl, J. M., and DeLuca, H. F.
TITLE:The avian vitamin D receptors: primary structures and their origins PubMed ID:7972109
JOURNAL:Proc Natl Acad Sci U S A.
VOL:91 PAGE : 11596-11600 (1994)
[TOP]

[0040]
AUTHOR:Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J., Haussler, M. R., Pike, J. W., Shine, J., and O'Malley, B. W.
TITLE:Cloning and expression of full-length cDNA encoding human vitamin D receptor PubMed ID:2835767
JOURNAL:Proc Natl Acad Sci U S A.
VOL:85 PAGE : 3294-3298 (1988)
[TOP]

[0041]
AUTHOR:Burmester, J. K., Maeda, N., and DeLuca, H. F.
TITLE:Isolation and expression of rat 1,25-dihydroxyvitamin D3 receptor cDNA PubMed ID:2829212
JOURNAL:Proc Natl Acad Sci U S A.
VOL:85 PAGE : 1005-1009 (1988)
[TOP]

[0042]
AUTHOR:Burmester, J. K., Wiese, R. J., Maeda, N., and DeLuca, H. F.
TITLE:Structure and regulation of the rat 1,25-dihydroxyvitamin D3 receptor PubMed ID:2849110
JOURNAL:Proc Natl Acad Sci U S A.
VOL:85 PAGE : 9499-9502 (1988)
[TOP]

[0043]
AUTHOR:Kamei, Y., Kawada, T., Fukuwatari, T., Ono, T., Kato, S., and Sugimoto, E.
TITLE:Cloning and sequencing of the gene encoding the mouse vitamin D receptor PubMed ID:7835717
JOURNAL:Gene.
VOL:152 PAGE : 281-282 (1995)
[TOP]

[0044]
AUTHOR:Darwish, H. M.; DeLuca, H. F.
TITLE:Identification of a 1,25-dihydroxyvitamin D3-response element in the 5'-flanking region of the rat calbindin D-9k gene. PubMed ID:1309950
JOURNAL:Proc. Natl. Acad. Sci. U.S.A.
VOL:89 PAGE : 603 -607 (1992)
[TOP]

[0045]
AUTHOR:Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M.
TITLE:DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3 PubMed ID:2153298
JOURNAL:Proc Natl Acad Sci U S A.
VOL:87 PAGE : 369-373 (1990)
[TOP]

[0046]
AUTHOR:Morrison, N. A., Shine, J., Fragonas, J. C., Verkest, V., McMenemy, M. L., and Eisman, J. A.
TITLE:1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene PubMed ID:2588000
JOURNAL:Science.
VOL:246 PAGE : 1158-1161 (1989)
[TOP]

[0047]
AUTHOR:Ozono, K., Liao, J., Kerner, S. A., Scott, R. A., and Pike, J. W.
TITLE:The vitamin D-responsive element in the human osteocalcin gene. Association with a nuclear proto-oncogene enhancer PubMed ID:2174889
JOURNAL:J Biol Chem.
VOL:265 PAGE : 21881-21888 (1990)
[TOP]

[0048]
AUTHOR:Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt, D. T.
TITLE:Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (SPP-1 or osteopontin) gene expression PubMed ID:2175918
JOURNAL:Proc Natl Acad Sci U S A.
VOL:87 PAGE : 9995-9999 (1990)
[TOP]

[0049]
AUTHOR:Zierold, C., Darwish, H. M., and DeLuca, H. F.
TITLE:Identification of a vitamin D-response element in the rat calcidiol (25-hydroxyvitamin D3) 24-hydroxylase gene PubMed ID:8302863
JOURNAL:Proc Natl Acad Sci U S A.
VOL:91 PAGE : 900-902 (1994)
[TOP]

[0050]
AUTHOR:Chen, K. S., and DeLuca, H. F.
TITLE:Cloning of the human 1 alpha,25-dihydroxyvitamin D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements PubMed ID:7632726
JOURNAL:Biochim Biophys Acta.
VOL:1263 PAGE : 1-9 (1995)
[TOP]

[0051]
AUTHOR:Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M., and Kato, Y.
TITLE:Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene PubMed ID:8144641
JOURNAL:J Biol Chem.
VOL:269 PAGE : 10545-10550 (1994)
[TOP]

[0052]
AUTHOR:Demay, M. B.; Kiernan, M. S.; DeLuca, H. F.; Kronenberg, H. M.
TITLE:Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3.
JOURNAL:Proc. Natl. Acad. Sci. U.S.A.
VOL:89 PAGE : 8097 -8101 (1992)
[TOP]

[0053]
AUTHOR:Takeda, T., Arakawa, M., and Kuwano, R.
TITLE:Organization and expression of the mouse spot35/calbindin-D28k gene: identification of the vitamin D-responsive promoter region PubMed ID:7980557
JOURNAL:Biochem Biophys Res Commun.
VOL:204 PAGE : 889-897 (1994)
[TOP]

[0054]
AUTHOR:Quelo, I., Kahlen, J. P., Rascle, A., Jurdic, P., and Carlberg, C.
TITLE:Identification and characterization of a vitamin D3 response element of chicken carbonic anhydrase-II PubMed ID:7811384
JOURNAL:DNA Cell Biol.
VOL:13 PAGE : 1181-1187 (1994)
[TOP]

[0055]
AUTHOR:Schrader, M., Nayeri, S., Kahlen, J. P., Muller, K. M., and Carlberg, C.
TITLE:Natural vitamin D3 response elements formed by inverted palindromes: polarity-directed ligand sensitivity of vitamin D3 receptor-retinoid X receptor heterodimer-mediated transactivation PubMed ID:7862109
JOURNAL:Mol Cell Biol.
VOL:15 PAGE : 1154-1161 (1995)
[TOP]

[0056]
AUTHOR:Gill, R. K., and Christakos, S.
TITLE:Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses PubMed ID:8464915
JOURNAL:Proc Natl Acad Sci U S A.
VOL:90 PAGE : 2984-2988 (1993)
[TOP]

[0057]
AUTHOR:Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., Kawakami, T., Arioka, K., Sato, H., Uchiyama, Y., et al.
TITLE:Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning PubMed ID:9241280
JOURNAL:Nat Genet.
VOL:16 PAGE : 391-396 (1997)
[TOP]

[0058]
AUTHOR:DeLuca, H. F.
TITLE:The vitamin D story: a collaborative effort of basic science and clinical medicine PubMed ID:3280376
JOURNAL:Faseb J.
VOL:2 PAGE : 224-236 (1988)
[TOP]

[0059]
AUTHOR:Reichel, H., Koeffler, H. P., and Norman, A. W.
TITLE:The role of the vitamin D endocrine system in health and disease PubMed ID:2648151
JOURNAL:N Engl J Med.
VOL:320 PAGE : 980-991 (1989)
[TOP]

[0060]
AUTHOR:Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., Yoshiki, S., and Suda, T.
TITLE:Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-dihydroxyvitamin D3 PubMed ID:6946446
JOURNAL:Proc Natl Acad Sci U S A.
VOL:78 PAGE : 4990-4994 (1981)
[TOP]

[0062]
AUTHOR:Parren, H. E.; DeLuca, H. F.; Schnoes, H. K.
TITLE:Direct C(1) Hydroxylation of Vitamin D3 and Related Compounds.
JOURNAL:J. Org. Chem.
VOL:45 PAGE : 3253 -3258 (1980)
[TOP]

[0063]
AUTHOR:Corradino, R. A., and Wasserman, R. H.
TITLE:1,25-Dihydroxycholecalciferol-like activity of Solanum malacoxylon extract on calcium transport PubMed ID:4437623
JOURNAL:Nature.
VOL:252 PAGE : 716-718 (1974)
[TOP]

[0065]
AUTHOR:Holick, M. F., Kleiner-Bossaller, A., Schnoes, H. K., Kasten, P. M., Boyle, I. T., and DeLuca, H. F.
TITLE:1,24,25-Trihydroxyvitamin D3. A metabolite of vitamin D3 effective on intestine PubMed ID:4355503
JOURNAL:J Biol Chem.
VOL:248 PAGE : 6691-6696 (1973)
[TOP]

[0066]
AUTHOR:Tanaka, Y., Castillo, L., and DeLuca, H. F.
TITLE:The 24-hydroxylation of 1,25-dihydroxyvitamin D3 PubMed ID:838723
JOURNAL:J Biol Chem.
VOL:252 PAGE : 1421-1424 (1977)
[TOP]

[0067]
AUTHOR:Mayer, E., Bishop, J. E., Chandraratna, R. A., Okamura, W. H., Kruse, J. R., Popjak, G., Ohnuma, N., and Norman, A. W.
TITLE:Isolation and identification of 1,25-dihydroxy-24-oxo-vitamin D3 and 1,23,25-trihydroxy-24-oxo-vitamin D3. New metabolites of vitamin D3 produced by a C-24 oxidation pathway of metabolism for 1,25-dihydroxyvitamin D3 present in intestine and kidney PubMed ID:6315697
JOURNAL:J Biol Chem.
VOL:258 PAGE : 13458-13465 (1983)
[TOP]

[0068]
AUTHOR:Napoli, J. L., Pramanik, B. C., Royal, P. M., Reinhardt, T. A., and Horst, R. L.
TITLE:Intestinal synthesis of 24-keto-1,25-dihydroxyvitamin D3. A metabolite formed in vivo with high affinity for the vitamin D cytosolic receptor PubMed ID:6307992
JOURNAL:J Biol Chem.
VOL:258 PAGE : 9100-9107 (1983)
[TOP]

[0069]
AUTHOR:Reddy, G. S., Tserng, K. Y., Thomas, B. R., Dayal, R., and Norman, A. W.
TITLE:Isolation and identification of 1,23-dihydroxy-24,25,26,27-tetranorvitamin D3, a new metabolite of 1,25-dihydroxyvitamin D3 produced in rat kidney PubMed ID:3828305
JOURNAL:Biochemistry.
VOL:26 PAGE : 324-331 (1987)
[TOP]

[0070]
AUTHOR:Esvelt, R. P., Schnoes, H. K., and DeLuca, H. F.
TITLE:Isolation and characterization of 1 alpha-hydroxy-23-carboxytetranorvitamin D: a major metabolite of 1,25-dihydroxyvitamin D3 PubMed ID:486408
JOURNAL:Biochemistry.
VOL:18 PAGE : 3977-3983 (1979)
[TOP]

[0073]
AUTHOR:Reddy, G. S., and Tserng, K. Y.
TITLE:Calcitroic acid, end product of renal metabolism of 1,25-dihydroxyvitamin D3 through C-24 oxidation pathway PubMed ID:2719932
JOURNAL:Biochemistry.
VOL:28 PAGE : 1763-1769 (1989)
[TOP]

[0076]
AUTHOR:Napoli, J. L., and Horst, R. L.
TITLE:(23S)-1,23,25-Trihydroxycholecalciferol, an intestinal metabolite of 1,25-dihydroxycholecalciferol PubMed ID:6688522
JOURNAL:Biochem J.
VOL:214 PAGE : 261-264 (1983)
[TOP]

[0077]
AUTHOR:Ohnuma, N., Bannai, K., Yamaguchi, H., Hashimoto, Y., and Norman, A. W.
TITLE:Isolation of a new metabolite of vitamin D produced in vivo, 1 alpha,25-dihydroxyvitamin D3-26,23-lactone PubMed ID:6252850
JOURNAL:Arch Biochem Biophys.
VOL:204 PAGE : 387-391 (1980)
[TOP]

[0084]
AUTHOR:Ishizuka, S., and Norman, A. W.
TITLE:Metabolic pathways from 1 alpha,25-dihydroxyvitamin D3 to 1 alpha,25-dihydroxyvitamin D3-26,23-lactone. Stereo-retained and stereo-selective lactonization PubMed ID:3034884
JOURNAL:J Biol Chem.
VOL:262 PAGE : 7165-7170 (1987)
[TOP]

[0087]
AUTHOR:Tanaka, Y., Schnoes, H. K., Smith, C. M., and DeLuca, H. F.
TITLE:1,25,26-trihydroxyvitamin D3: isolation, identification, and biological activity PubMed ID:6895295
JOURNAL:Arch Biochem Biophys.
VOL:210 PAGE : 104-109 (1981)
[TOP]

[0183]
AUTHOR:Norman, A. W., Bouillon, R., Farach-Carson, M. C., Bishop, J. E., Zhou, L. X., Nemere, I., Zhao, J., Muralidharan, K. R., and Okamura, W. H.
TITLE:Demonstration that 1 beta,25-dihydroxyvitamin D3 is an antagonist of the nongenomic but not genomic biological responses and biological profile of the three A-ring diastereomers of 1 alpha,25-dihydroxyvitamin D3 PubMed ID:8397195
JOURNAL:J Biol Chem.
VOL:268 PAGE : 20022-20030 (1993)
[TOP]

[0184]
AUTHOR:Haussler, M. R.
TITLE:Vitamin D receptors: nature and function PubMed ID:3015172
JOURNAL:Annu Rev Nutr.
VOL:6 PAGE : 527-562 (1986)
[TOP]

[0185]
AUTHOR:Morrison, N. A., Qi, J. C., Tokita, A., Kelly, P. J., Crofts, L., Nguyen, T. V., Sambrook, P. N., and Eisman, J. A.
TITLE:Prediction of bone density from vitamin D receptor alleles PubMed ID:8161378
JOURNAL:Nature.
VOL:367 PAGE : 284-287 (1994)
[TOP]

[0186]
AUTHOR:Suwinska, K.; Kutner, A.
TITLE:Crystal and Molecular Structure of 1,25-Dihydroxycholecalciferol.
JOURNAL:Acta Cryst.
VOL:52 PAGE : 550 -554 (1996)
[TOP]

[0235]
AUTHOR:Napoli, J. L., Mellon, W. S., Fivizzani, M. A., Schnoes, H. K., and DeLuca, H. F.
TITLE:Direct chemical synthesis of 1 alpha,25-dihydroxy[26,27-3H]vitamin D3 with high specific activity: its use in receptor studies PubMed ID:6892993
JOURNAL:Biochemistry.
VOL:19 PAGE : 2515-2521 (1980)
[TOP]

[0357]
AUTHOR:Baggiolini, E. G.; Iacobelli, J. A.; Hennessy, B. M.; Uskokovic, M. R.
TITLE:Stereoselective Total Synthesis of 1a,25-Dihydroxycholecalciferol.
JOURNAL:J. Am. Chem. Soc.
VOL:104 PAGE : 2945 -2948 (1982)
[TOP]

Last updated June 19, 2007. Copyright © 1989-2007 Japanese Conference on the Biochemistry of Lipids (JCBL). All rights reserved.